Propagation of LldR regulog to Shewanella sediminis HAW-EB3
| Source regulog: | LldR - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LysR |
| Regulation mode: | activator (repressor) |
| Biological process: | Lactate utilization |
| Effector: | L-lactate |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Shewanella sediminis HAW-EB3 |
| Orthologous TF(s) | Ssed_3921 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -149
Score: 6.1 Sequence: TAAATTAGCACTACTTATTAT
Locus tag: Ssed_3924
|
||||
| Ssed_3924 | -149 | 6.1 | TAAATTAGCACTACTTATTAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: lldE | ||||
| Ortholog function: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE | ||||
| Shewanella oneidensis MR-1 | SO_1520 | -123 | 6.2 | TAAATTAGGGCTACTTATTTA |
| Shewanella putrefaciens CN-32 | Sputcn32_1270 | -123 | 6.2 | TAAATTAGGACTACTTATTTC |
| Shewanella sp W3-18-1 | Sputw3181_2836 | -123 | 6.2 | TAAATTAGGACTACTTATTTC |
| Shewanella sp ANA-3 | Shewana3_2906 | -91 | 6.3 | TAAATTAGCGCTACTTATTTA |
| Shewanella sp MR-4 | Shewmr4_2736 | -123 | 6.3 | TAAATTAGCGCTACTTATTTA |
| Shewanella sp MR-7 | Shewmr7_2809 | -123 | 6.3 | TAAATTAGCGCTACTTATTTA |
| Shewanella baltica OS155 | Sbal_1352 | -123 | 5.7 | TAAATTAGGGCTACTTATTCC |
| Shewanella frigidimarina NCIMB 400 | Sfri_1852 | -133 | 5.2 | TTAATTAGCACTACATTTTAT |
| Shewanella amazonensis SB2B | Sama_2441 | -115 | 4.1 | TActaAAtTACcACTAtTTTA |
| Shewanella loihica PV-4 | Shew_3004 | -154 | 6.1 | TAAATTAGCACTACTTATTAT |
| Shewanella pealeana ATCC 700345 | Spea_2996 | -168 | 5.8 | TAAATTAGCACTACTTTTTAC |
| Shewanella halifaxensis HAW-EB4 | Shal_3085 | -168 | 5.8 | TAAATTAGCACTACTTTTTAC |
| Shewanella piezotolerans WP3 | swp_3635 | -154 | 5.8 | TAAATTAGCACTACTTTTTAT |
| Shewanella sediminis HAW-EB3 | Ssed_3924 | -149 | 6.1 | TAAATTAGCACTACTTATTAT |