Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of KdgR regulog to Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. CVM23701

Reference regulog properties
Source regulog: KdgR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor (activator)
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. CVM23701
Orthologous TF(s) Sententer_010100020247
Regulated genes 7
Built upon 159 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. CVM23701
Locus tag Position Score Sequence
Position: -34
Score: 5.8
Sequence: AAATAAAACATTATTTTAATT
Locus tag: Sententer_010100006959
Sententer_010100006959 -34 5.8 AAATAAAACATTATTTTAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: kdgX
Ortholog function: predicted 2-keto-3-deoxygluconate permease
Salmonella typhimurium LT2 STM4395 -34 5.8 AAATAAAACATTATTTTAATT
Citrobacter koseri ATCC BAA-895 CKO_03627 -31 5.2 AAATAAAACATTATTTCAAAG
Enterobacter sp. 638 Ent638_0375 -33 5.9 AATTGAAACGTCATTTTATTT
Yersinia pestis KIM y1734 -22 5.8 TAACGAAACATCATTTCATTT
Position: -32
Score: 5.7
Sequence: AAATAAAACGCTGTTTTAACT
Locus tag: Sententer_010100007414
Sententer_010100007414 -32 5.7 AAATAAAACGCTGTTTTAACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yjgK
Ortholog function: cytoplasmic protein involved in polygalacturonate utilization
Escherichia coli str. K-12 substr. MG1655 b4252 -35 6 AAATGAAACGTTGTTTTAATT
Salmonella typhimurium LT2 STM4468 -32 5.7 AAATAAAACGCTGTTTTAACT
Citrobacter koseri ATCC BAA-895 CKO_03553 -33 6.2 AAATGAAACGTTGTTTTATTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04658 -33 5.8 AAATGAAATGCTGTTTTATAT
Enterobacter sp. 638 Ent638_0453 -34 6 AAATGAAACATTGTTTTATAT
Yersinia pestis KIM y0739 -41 5.9 TAATAAAACAGCATTTCATTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0383 -41 5.1 TTGTAAAACAGGGTTTCATTT
Edwardsiella tarda EIB202 ETAE_3112 -39 5.6 AAATAAAACGCAGTTTTATAA
Position: -126
Score: 4.7
Sequence: ATGTGAAACAGGGTTTCAAAA
Locus tag: Sententer_010100009086
Sententer_010100009086 -126 4.7 ATGTGAAACAGGGTTTCAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: rhiA
Ortholog function: predicted rhamnogalacturonide TRAP transporter, substrate-binding subunit
Salmonella typhimurium LT2 STM4054 -126 4.7 ATGTGAAACAGGGTTTCAAAA
Position: -108
Score: 5.3
Sequence: TAATGAAACCTGGTTTTATTA
Locus tag: Sententer_010100022529
Sententer_010100022529 -108 5.3 TAATGAAACCTGGTTTTATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: spiX
Ortholog function: predicted 5-keto-4-deoxyuronate isomerase
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1742 -54 5.1 AATTGAAATACAGTTTTAAAA
Position: -131
Score: 4.9
Sequence: AAATGAAACACACTTTTCATT
Locus tag: Sententer_010100023144
Sententer_010100023144 -131 4.9 AAATGAAACACACTTTTCATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ppsR
Ortholog function: PEP synthetase regulatory protein
Escherichia coli str. K-12 substr. MG1655 b1703 -131 5.3 AAATGAAATGCTGTTTTCATA
Salmonella typhimurium LT2 STM1348 -131 4.9 AAATGAAACACACTTTTCATT
Citrobacter koseri ATCC BAA-895 CKO_01727 -107 5.5 TATAAAAATAGCGTTTCATTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02161 -97 5.1 AACAAAAATAGCGTTTCAATT
Enterobacter sp. 638 Ent638_1744 -107 5.3 ATTAAAAACACCATTTCATTT
Serratia proteamaculans 568 Spro_2173 -134 5.2 ATTTGAAATAGTGTTTTACTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1852 -94 5.6 TAATGAAATGGCGTTTTAATA
Position: -226
Score: 4.9
Sequence: AATGAAAAGTGTGTTTCATTT
Locus tag: Sententer_010100023154
Sententer_010100023154 -226 4.9 AATGAAAAGTGTGTTTCATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ppsA
Ortholog function: Phosphoenolpyruvate synthase (EC 2.7.9.2)
Escherichia coli str. K-12 substr. MG1655 b1702 -222 5.3 TATGAAAACAGCATTTCATTT
Salmonella typhimurium LT2 STM1349 -226 4.9 AATGAAAAGTGTGTTTCATTT
Citrobacter koseri ATCC BAA-895 CKO_01725 -249 5.5 AAATGAAACGCTATTTTTATA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02160 -254 5.1 AATTGAAACGCTATTTTTGTT
Enterobacter sp. 638 Ent638_1745 -249 5.3 AAATGAAATGGTGTTTTTAAT
Serratia proteamaculans 568 Spro_2174 -364 5.2 AAgTaAAACAcTaTTTCAaaT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1853 -227 5.6 TATTAAAACGCCATTTCATTA
© 2009-2020 RegPrecise