Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of KdgR regulog to Salmonella enterica subsp. enterica serovar Kentucky str. CDC 191

Reference regulog properties
Source regulog: KdgR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor (activator)
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Kentucky str. CDC 191
Orthologous TF(s) Sententerica_010100024992
Regulated genes 10
Built upon 159 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Kentucky str. CDC 191
Locus tag Position Score Sequence
Position: -34
Score: 5.8
Sequence: AAATAAAACATTATTTTAATT
Locus tag: Sententerica_010100017289
Sententerica_010100017289 -34 5.8 AAATAAAACATTATTTTAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: kdgX
Ortholog function: predicted 2-keto-3-deoxygluconate permease
Salmonella typhimurium LT2 STM4395 -34 5.8 AAATAAAACATTATTTTAATT
Citrobacter koseri ATCC BAA-895 CKO_03627 -31 5.2 AAATAAAACATTATTTCAAAG
Enterobacter sp. 638 Ent638_0375 -33 5.9 AATTGAAACGTCATTTTATTT
Yersinia pestis KIM y1734 -22 5.8 TAACGAAACATCATTTCATTT
Position: -32
Score: 5.7
Sequence: AAATAAAACGCTGTTTTAACT
Locus tag: Sententerica_010100017609
Sententerica_010100017609 -32 5.7 AAATAAAACGCTGTTTTAACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yjgK
Ortholog function: cytoplasmic protein involved in polygalacturonate utilization
Escherichia coli str. K-12 substr. MG1655 b4252 -35 6 AAATGAAACGTTGTTTTAATT
Salmonella typhimurium LT2 STM4468 -32 5.7 AAATAAAACGCTGTTTTAACT
Citrobacter koseri ATCC BAA-895 CKO_03553 -33 6.2 AAATGAAACGTTGTTTTATTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04658 -33 5.8 AAATGAAATGCTGTTTTATAT
Enterobacter sp. 638 Ent638_0453 -34 6 AAATGAAACATTGTTTTATAT
Yersinia pestis KIM y0739 -41 5.9 TAATAAAACAGCATTTCATTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0383 -41 5.1 TTGTAAAACAGGGTTTCATTT
Edwardsiella tarda EIB202 ETAE_3112 -39 5.6 AAATAAAACGCAGTTTTATAA
Position: -126
Score: 4.7
Sequence: ATGTGAAACAGGGTTTCAAAA
Locus tag: Sententerica_010100018556
Sententerica_010100018556 -126 4.7 ATGTGAAACAGGGTTTCAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: rhiA
Ortholog function: predicted rhamnogalacturonide TRAP transporter, substrate-binding subunit
Salmonella typhimurium LT2 STM4054 -126 4.7 ATGTGAAACAGGGTTTCAAAA
Position: -131
Score: 4.9
Sequence: AAATGAAACACACTTTTCATT
Locus tag: Sententerica_010100021304
Sententerica_010100021304 -131 4.9 AAATGAAACACACTTTTCATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ppsR
Ortholog function: PEP synthetase regulatory protein
Escherichia coli str. K-12 substr. MG1655 b1703 -131 5.3 AAATGAAATGCTGTTTTCATA
Salmonella typhimurium LT2 STM1348 -131 4.9 AAATGAAACACACTTTTCATT
Citrobacter koseri ATCC BAA-895 CKO_01727 -107 5.5 TATAAAAATAGCGTTTCATTT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02161 -97 5.1 AACAAAAATAGCGTTTCAATT
Enterobacter sp. 638 Ent638_1744 -107 5.3 ATTAAAAACACCATTTCATTT
Serratia proteamaculans 568 Spro_2173 -134 5.2 ATTTGAAATAGTGTTTTACTT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1852 -94 5.6 TAATGAAATGGCGTTTTAATA
Position: -226
Score: 4.9
Sequence: AATGAAAAGTGTGTTTCATTT
Locus tag: Sententerica_010100021314
Sententerica_010100021314 -226 4.9 AATGAAAAGTGTGTTTCATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ppsA
Ortholog function: Phosphoenolpyruvate synthase (EC 2.7.9.2)
Escherichia coli str. K-12 substr. MG1655 b1702 -222 5.3 TATGAAAACAGCATTTCATTT
Salmonella typhimurium LT2 STM1349 -226 4.9 AATGAAAAGTGTGTTTCATTT
Citrobacter koseri ATCC BAA-895 CKO_01725 -249 5.5 AAATGAAACGCTATTTTTATA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02160 -254 5.1 AATTGAAACGCTATTTTTGTT
Enterobacter sp. 638 Ent638_1745 -249 5.3 AAATGAAATGGTGTTTTTAAT
Serratia proteamaculans 568 Spro_2174 -364 5.2 AAgTaAAACAcTaTTTCAaaT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1853 -227 5.6 TATTAAAACGCCATTTCATTA
Position: -286
Score: 4.7
Sequence: TTTTGAAACAGGGTTTTCATT
Locus tag: Sententerica_010100021479
Sententerica_010100021479 -286 4.7 TTTTGAAACAGGGTTTTCATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: pykF
Ortholog function: Pyruvate kinase (EC 2.7.1.40)
Escherichia coli str. K-12 substr. MG1655 b1676 -286 5 TTTTGAAACGCTGTTTTTGTT
Salmonella typhimurium LT2 STM1378 -286 4.7 TTTTGAAACAGGGTTTTCATT
Citrobacter koseri ATCC BAA-895 CKO_01709 -286 5 TTTTGAAACGCTGTTTTCATT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02133 -285 5 ATTTGAAACGAGGTTTTTATT
Enterobacter sp. 638 Ent638_1768 -286 5.1 TTTTGAAACGCCGTTTCCATT
Serratia proteamaculans 568 Spro_2187 -203 4.1 AAtaacAACAcatTTTCATcT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1867 -259 5.1 ATACGGAACGTCGTTTCAATT
Position: -108
Score: 5.5
Sequence: TAATGAAACTTGGTTTCATTA
Locus tag: Sententerica_010100023651
Sententerica_010100023651 -108 5.5 TAATGAAACTTGGTTTCATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: spiX
Ortholog function: predicted 5-keto-4-deoxyuronate isomerase
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1742 -54 5.1 AATTGAAATACAGTTTTAAAA
Position: -231
Score: 5.4
Sequence: TTATGAAACATTGTTTCAGAT
Locus tag: Sententerica_010100023671
Sententerica_010100023671 -231 5.4 TTATGAAACATTGTTTCAGAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: tpfX
Ortholog function: ThiJ/PfpI-family hypothetical protein
Salmonella typhimurium LT2 STM1931 -231 5.4 TTATGAAACATTGTTTCAGAT
Citrobacter koseri ATCC BAA-895 CKO_01049 -199 5.4 TTTTGAAATGATGTTTCATAT
Enterobacter sp. 638 Ent638_2477 -42 5 GGATGAAACGCTGTTTTAAAT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0102 -85 6.1 TAATAAAACATCGTTTCATTT