Propagation of RhmR regulog to Chloroflexus aurantiacus J-10-fl
| Source regulog: | RhmR - Chloroflexia |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Rhamnose oligosaccharides utilization |
| Effector: | |
| Phylum: | Chloroflexi |
| Propagated regulon: | |
| Target genome | Chloroflexus aurantiacus J-10-fl |
| Orthologous TF(s) | Caur_0365 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -177
Score: 5.7 Sequence: CATACCGATCGATGCCCAGG
Locus tag: Caur_0364
|
||||
| Caur_0364 | -177 | 5.7 | CATACCGATCGATGCCCAGG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: rhmE | ||||
| Ortholog function: Predicted rhamnose oligosaccharide ABC transporter, extracellular solute-binding component | ||||
| Chloroflexus sp. Y-400-fl | Chy400_0391 | -177 | 5.7 | CATACCGATCGATGCCCAGG |