Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing rhmE gene

Properties
Regulog: RhmR - Chloroflexia
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Rhamnose oligosaccharides utilization
Effector:
Phylum: Chloroflexi
Built upon 1 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chloroflexus sp. Y-400-fl
Position: -177
Score: 5.6567
Sequence: CATACCGATCGATGCCCAGG
Locus tag: Chy400_0391
Name: rhmE
Funciton: Predicted rhamnose oligosaccharide ABC transporter, extracellular solute-binding component
Locus tag: Chy400_0390
Name: rhmF
Funciton: Predicted rhamnose oligosaccharide ABC transporter, inner membrane component
Locus tag: Chy400_0389
Name: rhmG
Funciton: Predicted rhamnose oligosaccharide ABC transporter, inner membrane component
Locus tag: Chy400_0388
Name: rhmA
Funciton: alpha-L-rhamnosidase
Locus tag: Chy400_0387
Name: GH1
Funciton: glycoside hydrolase family 1
rhmE-rhmF-rhmG-rhmA-GH1 -177 5.7 CATACCGATCGATGCCCAGG Chy400_0391