Propagation of RhmR regulog to Chloroflexus sp. Y-400-fl

Reference regulog properties
Source regulog:	RhmR - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Rhamnose oligosaccharides utilization
Effector:
Phylum:	Chloroflexi
Propagated regulon:
Target genome	Chloroflexus sp. Y-400-fl
Orthologous TF(s)	Chy400_0392
Regulated genes	1

Built upon 1 sites [see more]

Predicted regulatory interactions in *Chloroflexus sp. Y-400-fl*
	Locus tag	Position	Score	Sequence
Position: -177 Score: 5.7 Sequence: CATACCGATCGATGCCCAGG Locus tag: Chy400_0391
	Chy400_0391	-177	5.7	CATACCGATCGATGCCCAGG
Supported by regulated orthologs from reference regulons
Ortholog gene name: rhmE
Ortholog function: Predicted rhamnose oligosaccharide ABC transporter, extracellular solute-binding component
Chloroflexus sp. Y-400-fl	Chy400_0391	-177	5.7	CATACCGATCGATGCCCAGG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --