Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CtsR regulog to Pediococcus pentosaceus ATCC 25745

Reference regulog properties
Source regulog: CtsR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Propagated regulon:
Target genome Pediococcus pentosaceus ATCC 25745
Orthologous TF(s) PEPE_1428
Regulated genes 2
Built upon 44 sites [see more]
Predicted regulatory interactions in Pediococcus pentosaceus ATCC 25745
Locus tag Position Score Sequence
Position: -95
Score: 6.9
Sequence: AAATATTTGACCTTTTTTGACCAA
Locus tag: PEPE_0455
PEPE_0455 -95 6.9 AAATATTTGACCTTTTTTGACCAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: clpP
Ortholog function: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Lactobacillus brevis ATCC 367 LVIS_0654 -90 6.2 TTTTGTTTGACCTACTCTGACCTT
Lactobacillus casei ATCC 334 LSEI_0963 -85 7 AAATCTTTGACCTTATTTGACTTT
Lactobacillus fermentum IFO 3956 LAF_0360 -90 6.6 AATGATTTGACCTTTTTTGACCTA
Lactobacillus plantarum WCFS1 lp_0786 -92 5.8 TTTCTTTTGACCTTCACTGACCTT
Lactobacillus reuteri JCM 1112 LAR_0379 -93 6.7 AAACATTTGACCTTTTTTGACCAA
Lactobacillus rhamnosus GG LGG_00931 -88 7 AAATCTTTGACCTTATTTGACTTT
Lactobacillus sakei subsp. sakei 23K LSA0531 -116 6 TACCATTTGACCATAGTTGACCTT
Lactobacillus salivarius subsp. salivarius UCC118 LSL_1168 -101 6.3 TTAAATTTGACCATTATTGACCTT
Pediococcus pentosaceus ATCC 25745 PEPE_0455 -95 6.9 AAATATTTGACCTTTTTTGACCAA
Position: -107
Score: 6
Sequence: AGATGTCTGACCAAATTTGACTAT
Locus tag: PEPE_0894
PEPE_0894 -107 6 AGATGTCTGACCAAATTTGACTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: hrcA
Ortholog function: Heat shock response transcriptional regulator HrcA, HrcA family
Lactobacillus fermentum IFO 3956 LAF_0749 -89 6.4 AGATCTTTGACTTTTGTTGACTTT
Lactobacillus plantarum WCFS1 lp_2029 -91 5.9 AATACTTTGTCTTTCCTTGACTTT
Lactobacillus reuteri JCM 1112 LAR_0677 -101 6.5 AATTGTTTGACGTTTCTTGACTTT
Lactobacillus sakei subsp. sakei 23K LSA1238 -87 5.3 CAATTCTTGACTTTATTTGACGTT
Pediococcus pentosaceus ATCC 25745 PEPE_0894 -107 6 AGATGTCTGACCAAATTTGACTAT