Propagation of XylR regulog to Pediococcus pentosaceus ATCC 25745

Reference regulog properties
Source regulog:	XylR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Pediococcus pentosaceus ATCC 25745
Orthologous TF(s)	PEPE_0186
Regulated genes	2

Built upon 15 sites [see more]

Predicted regulatory interactions in *Pediococcus pentosaceus ATCC 25745*
	Locus tag	Position	Score	Sequence
Position: -182 Score: 5.1 Sequence: GTTTGTTAGTTCTATTTACAAAC Locus tag: PEPE_0184
	PEPE_0184	-182	5.1	GTTTGTTAGTTCTATTTACAAAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: xylS
Ortholog function: Alpha-xylosidase (EC 3.2.1.-)
Lactobacillus brevis ATCC 367	LVIS_0462	-150	5.3	GTTGGTTTAGTAAACCAATTTAC
Pediococcus pentosaceus ATCC 25745	PEPE_0184	-182	5.1	GTTTGTTAGTTCTATTTACAAAC

Position: -66 Score: 5.1 Sequence: GTTTGTAAATAGAACTAACAAAC Locus tag: PEPE_0185
	PEPE_0185	-66	5.1	GTTTGTAAATAGAACTAACAAAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: xynT
Ortholog function: Xyloside transporter XynT
Lactobacillus brevis ATCC 367	LVIS_0463	-151	5.3	GTAAATTGGTTTACTAAACCAAC
Pediococcus pentosaceus ATCC 25745	PEPE_0185	-66	5.1	GTTTGTAAATAGAACTAACAAAC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --