Propagation of IscR regulog to Yersinia pestis FV-1

Reference regulog properties
Source regulog:	IscR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Yersinia pestis FV-1
Orthologous TF(s)	No orthologous TFs found
Regulated genes	1

Built upon 45 sites [see more]

Predicted regulatory interactions in *Yersinia pestis FV-1*
	Locus tag	Position	Score	Sequence
Position: -37 Score: 6.3 Sequence: ATAACCGACAAGAGTAGTCAACTAT Locus tag: YpesF_010100012464
	YpesF_010100012464	-37	6.3	ATAACCGACAAGAGTAGTCAACTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nfuA
Ortholog function: NfuA Fe-S protein maturation
Escherichia coli str. K-12 substr. MG1655	b3414	-37	6.9	ATAACCAACTAAAATAGTCAACTAT
Salmonella typhimurium LT2	STM3511	-37	6.9	ATAACCAACTAAAATAGTCAACTAT
Citrobacter koseri ATCC BAA-895	CKO_04835	-37	6.7	ATAACCAAGTAAAATAGTCAACTAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_03784	-37	6.5	ATAACCCAGTAAAATAGTCAACTAT
Enterobacter sp. 638	Ent638_3827	-37	6.1	ATACCCAAGTATTTTAGTCAACTAT
Erwinia amylovora ATCC 49946	EAM_3259	-37	6.7	ATAACCAACTGAATTAGTCAACTAT
Yersinia pestis KIM	y3903	-37	6.3	ATAACCGACAAGAGTAGTCAACTAT
Serratia proteamaculans 568	Spro_4634	-46	5.7	ATAACCTAGTATAGAAGTCAACTAT
Erwinia carotovora subsp. atroseptica SCRI1043	ECA4134	-38	5.6	ATAACCGATAAGTGCAGTCAACTAT
Edwardsiella tarda EIB202	ETAE_3288	-37	5.9	ATAACCGACCGGAGAAGTCAACTAT
Proteus mirabilis HI4320	PMI2926	-38	6.3	ATAACCAACCAGAACAGTCAACTAT
Photorhabdus luminescens subsp. laumondii TTO1	plu0198	-37	6.3	ATAACCAACTATAGCAGTCAACTAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --