Propagation of SoxR regulog to Pseudoalteromonas tunicata D2

Reference regulog properties
Source regulog:	SoxR - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Superoxide stress response
Effector:	Paraquat
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Pseudoalteromonas tunicata D2
Orthologous TF(s)	PTD2_05750, PTD2_21097
Regulated genes	2

Built upon 12 sites [see more]

Predicted regulatory interactions in *Pseudoalteromonas tunicata D2*
	Locus tag	Position	Score	Sequence
Position: -32 Score: 4.9 Sequence: ACTTCAAGTCGACTTTAAGT Locus tag: PTD2_21097
	PTD2_21097	-32	4.9	ACTTCAAGTCGACTTTAAGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: soxR
Ortholog function: Redox-sensitive transcriptional activator, MerR family
Shewanella amazonensis SB2B	Sama_3347	-32	6.2	ACTTCAAGTCAACTTGAGGT
Shewanella loihica PV-4	Shew_0423	-32	5.7	ACTTCAAGTCGACTTGAGGT
Shewanella woodyi ATCC 51908	Swoo_3439	-113	4.4	AgtTaAAGTcgACTTtAaGT

Position: -63 Score: 6.8 Sequence: ACCTCAAGATAACTTGAGGT Locus tag: PTD2_05750
	PTD2_05750	-63	6.8	ACCTCAAGATAACTTGAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: soxR
Ortholog function: Redox-sensitive transcriptional activator, MerR family
Shewanella denitrificans OS217	Sden_2125	-116	7.3	ACCTCAAGTTAGCTTGAGGT
Shewanella frigidimarina NCIMB 400	Sfri_1565	-64	7	ACCTAAAGCTAACTTGAGGT
Shewanella piezotolerans WP3	swp_2307	-49	6	ATCTCAAGTTAACTTTAGAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --