Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SO0072 regulog to Shewanella oneidensis MR-1

Reference regulog properties
Source regulog: SO0072 - Shewanellaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Hypothetical ABC transporter
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shewanella oneidensis MR-1
Orthologous TF(s) SO0072
Regulated genes 2
Built upon 29 sites [see more]
Predicted regulatory interactions in Shewanella oneidensis MR-1
Locus tag Position Score Sequence
Position: -78
Score: 7.1
Sequence: TGTATTAATACATTGATACA
Locus tag: SO0071
SO0071 -78 7.1 TGTATTAATACATTGATACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF00561
Ortholog function: Hydrolase, alpha/beta hydrolase fold family
Shewanella oneidensis MR-1 SO0071 -78 7.1 TGTATTAATACATTGATACA
Shewanella putrefaciens CN-32 Sputcn32_0057 -79 7.1 TGTATTAATACATTGATACA
Shewanella sp W3-18-1 Sputw3181_4021 -79 7.1 TGTATTAATACATTGATACA
Shewanella sp ANA-3 Shewana3_0076 -78 7.1 TGTATTAATACATTGATACA
Shewanella sp MR-4 Shewmr4_0074 -78 7.1 TGTATTAATACATTGATACA
Shewanella sp MR-7 Shewmr7_0072 -78 7.1 TGTATTAATACATTGATACA
Shewanella baltica OS155 Sbal_4278 -79 7.1 TGTATTAATACATTGATACA
Shewanella denitrificans OS217 Sden_0068 -73 6.9 TGTATTAATTCATTGATACA
Shewanella frigidimarina NCIMB 400 Sfri_3977 -80 7.1 TGTATTAATACATTGATACA
Shewanella amazonensis SB2B Sama_3575 -83 6.1 TGAATCACTGTATTAATACA
-75 7.1 TGTATTAATACATTGATACA
Shewanella loihica PV-4 Shew_3780 -101 7.1 TGTATTAATACATTGATACA
Shewanella pealeana ATCC 700345 Spea_4190 -76 7.1 TGTATTAATACATTGATACA
Shewanella piezotolerans WP3 swp_0108 -133 7.1 TGTATTAATACATTGATACA
Shewanella woodyi ATCC 51908 Swoo_4864 -75 7.1 TGTATTAATACATTGATACA
Position: -34
Score: 7.1
Sequence: TGTATCAATGTATTAATACA
Locus tag: SO0072
SO0072 -34 7.1 TGTATCAATGTATTAATACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: SO0072
Ortholog function: Transcriptional regulator, GntR family, YtrA subfamily
Shewanella oneidensis MR-1 SO_0072 -34 7.1 TGTATCAATGTATTAATACA
Shewanella putrefaciens CN-32 Sputcn32_0058 -34 7.1 TGTATCAATGTATTAATACA
Shewanella sp W3-18-1 Sputw3181_4020 -34 7.1 TGTATCAATGTATTAATACA
Shewanella baltica OS155 Sbal_4277 -34 7.1 TGTATCAATGTATTAATACA
Shewanella denitrificans OS217 Sden_0069 -34 6.9 TGTATCAATGAATTAATACA
Shewanella amazonensis SB2B Sama_3574 -34 7.1 TGTATCAATGTATTAATACA
Shewanella pealeana ATCC 700345 Spea_4189 -34 7.1 TGTATCAATGTATTAATACA
Shewanella piezotolerans WP3 swp_0109 -34 7.1 TGTATCAATGTATTAATACA
Shewanella woodyi ATCC 51908 Swoo_4863 -34 7.1 TGTATCAATGTATTAATACA