Profile of regulator Reut_C5892 in Ralstonia
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Regulog: | Reut_C5892 - Ralstonia |
Member of regulog collections
- By taxonomy - Ralstonia
- By TF family - LacI
- By pathway - Sugar utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Ralstonia eutropha JMP134 | |||||
| Reut_C5893 | Reut_C5893 | -81 | 5.6 | TAATGACTACGTAACCAAAT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |