Regulog Reut_C5892 - Ralstonia

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/beta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes							Function

CRON 1.
Reut_C5893	Cupriavidus taiwanensis	Ralstonia eutropha H16	* Ralstonia eutropha JMP134 Site: position = -81 score = 5.58013 sequence = TAATGACTACGTAACCAAAT Gene: Reut_C5893: Putative membrane protein	Ralstonia metallidurans CH34	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000	Putative membrane protein
Reut_C5894	Cupriavidus taiwanensis	Ralstonia eutropha H16	Ralstonia eutropha JMP134 Gene: Reut_C5894: Putative dehydratase	Ralstonia metallidurans CH34	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000	Putative dehydratase
Reut_C5895	Cupriavidus taiwanensis	Ralstonia eutropha H16	Ralstonia eutropha JMP134 Gene: Reut_C5895: Putative exported protein	Ralstonia metallidurans CH34	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000	Putative exported protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --