Profile of regulator ManR2 in Alteromonadales

Properties
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannosides utilization; Mannose utilization
Effector:	Mannose
Regulog:	ManR2 - Alteromonadales

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Mannose
By pathway - Mannosides utilization
By pathway - Mannose utilization

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Pseudoalteromonas atlantica T6c
	Patl_0120	mnnA1	-133	6.7	AATTGTAATCGATTACAATT
	Patl_0120	mnnA1	-228	6	TACTGTAATCGATAACAAAA
	Patl_0121	manR2	-144	6	TTTTGTTATCGATTACAGTA
	Patl_0121	manR2	-239	6.7	AATTGTAATCGATTACAATT
	Patl_0122	omp(Man)	-165	6.8	AATTGTAATCGATTACATTT

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD