Regulog ManR2 - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Mannosides utilization; Mannose utilization |
| Effector: | Mannose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By TF family - LacI
- By effector - Mannose
- By pathway - Mannosides utilization
- By pathway - Mannose utilization
| Genome | Genes | Operons |
|---|---|---|
| Pseudoalteromonas atlantica T6c | 8 | 3 |
| Pseudoalteromonas haloplanktis TAC125 | ||
| Pseudoalteromonas tunicata D2 | ||
| Alteromonadales bacterium TW-7 | ||
| Alteromonas macleodii 'Deep ecotype' | ||
| Colwellia psychrerythraea 34H | ||
| Glaciecola sp. HTCC2999 | ||
| Idiomarina baltica OS145 | ||
| Idiomarina loihiensis L2TR |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| manR2 |
*
Pseudoalteromonas atlantica T6c Site: position = -144 score = 6.04161 sequence = TTTTGTTATCGATTACAGTA Site: position = -239 score = 6.74508 sequence = AATTGTAATCGATTACAATT Gene: Patl_0121: Transcriptional regulator of mannoside utilization, variant 2, LacI family |
|
|
|
|
|
|
|
|
Transcriptional regulator of mannoside utilization, variant 2, LacI family |
| CRON 2. | ||||||||||
| mnnA1 |
*3
Pseudoalteromonas atlantica T6c Gene: Patl_0117: Alpha-1,2-mannosidase Gene: Patl_0116: Alpha-1,2-mannosidase Site: position = -133 score = 6.74508 sequence = AATTGTAATCGATTACAATT Site: position = -228 score = 6.04161 sequence = TACTGTAATCGATAACAAAA Gene: Patl_0120: Alpha-1,2-mannosidase |
|
Gene: PTD2_02161: Alpha-1,2-mannosidase |
|
|
2
Colwellia psychrerythraea 34H Gene: CPS_2651: Alpha-1,2-mannosidase Gene: CPS_2650: Alpha-1,2-mannosidase |
|
|
|
Alpha-1,2-mannosidase |
| manP |
Gene: Patl_0119: Predicted mannose transporter, GGP family |
|
Gene: PTD2_02166: Predicted mannose transporter, GGP family |
Gene: ATW7_00410: Predicted mannose transporter, GGP family |
|
Gene: CPS_2649: Predicted mannose transporter, GGP family |
|
|
|
Predicted mannose transporter, GGP family |
| manI |
Gene: Patl_0118: D-mannose isomerase (EC 5.3.1.7) |
|
Gene: PTD2_02171: D-mannose isomerase (EC 5.3.1.7) |
|
Gene: MADE_01636: D-mannose isomerase (EC 5.3.1.7) |
Gene: CPS_2647: D-mannose isomerase (EC 5.3.1.7) |
|
|
|
D-mannose isomerase (EC 5.3.1.7) |
| CRON 3. | ||||||||||
| omp(Man) |
*
Pseudoalteromonas atlantica T6c Site: position = -165 score = 6.78347 sequence = AATTGTAATCGATTACATTT Gene: Patl_0122: Mannosides-regulated TonB-dependent outer membrane receptor |
Gene: PSHAb0165: Mannosides-regulated TonB-dependent outer membrane receptor |
Gene: PTD2_22047: Mannosides-regulated TonB-dependent outer membrane receptor |
|
|
Gene: CPS_2653: Mannosides-regulated TonB-dependent outer membrane receptor |
|
|
|
Mannosides-regulated TonB-dependent outer membrane receptor |
| mnnA2 |
Gene: Patl_0123: Alpha-1,2-mannosidase |
|
|
|
|
|
|
|
|
Alpha-1,2-mannosidase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |