Profile of regulator BglR in Enterococcaceae
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Regulog: | BglR - Enterococcaceae |
Member of regulog collections
- By taxonomy - Enterococcaceae
- By TF family - LacI
- By effector - Beta-glucoside
- By pathway - Beta-glucosides utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Enterococcus faecalis V583 | |||||
| EF1232 | bglB | -39 | 6.8 | TTGTAGAAACGTTTCACTAA | |
| EF1232 | bglB | -217 | 6.8 | TTGGTGAAACGTTTCTATAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |