Regulog BglR - Enterococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterococcaceae
- By TF family - LacI
- By effector - Beta-glucoside
- By pathway - Beta-glucosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Enterococcus faecalis V583 | 9 | 1 |
| Enterococcus faecium DO |
| Genes | Function | ||
|---|---|---|---|
| CRON 1. | |||
| bglB |
*
Enterococcus faecalis V583 Site: position = -39 score = 6.83644 sequence = TTGTAGAAACGTTTCACTAA Site: position = -217 score = 6.83644 sequence = TTGGTGAAACGTTTCTATAA Gene: EF1232: Predicted beta-glucoside ABC transport system, permease protein 1 |
|
Predicted beta-glucoside ABC transport system, permease protein 1 |
| bglC |
Gene: EF1233: Predicted beta-glucoside ABC transport system, permease protein 2 |
|
Predicted beta-glucoside ABC transport system, permease protein 2 |
| bglA |
Gene: EF1234: Predicted beta-glucoside ABC transport system, sugar-binding protein |
|
Predicted beta-glucoside ABC transport system, sugar-binding protein |
| EF1235 |
Gene: EF1235: Hypothetical protein |
|
Hypothetical protein |
| EF1236 |
Gene: EF1236: Putative acetyl xylan esterase |
|
Putative acetyl xylan esterase |
| EF1237 |
Gene: EF1237: Conserved hypothetical protein |
|
Conserved hypothetical protein |
| bglX |
Gene: EF1238: Beta-glucosidase (EC 3.2.1.21) |
|
Beta-glucosidase (EC 3.2.1.21) |
| cbpA |
Gene: EF1239: Cellobiose phosphorylase (EC 2.4.1.-) |
|
Cellobiose phosphorylase (EC 2.4.1.-) |
| bglR |
Gene: EF1240: Transcriptional regulator for beta-glucoside utilization, LacI family |
|
Transcriptional regulator for beta-glucoside utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |