Profile of regulator IolR in Oceanospirillales/Alteromonadales
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Inositol utilization |
| Effector: | |
| Regulog: | IolR - Oceanospirillales/Alteromonadales |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By TF family - LacI
- By pathway - Inositol utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Hahella chejuensis KCTC 2396 | |||||
| HCH_03296 | null | -76 | 6.1 | TTTTGCACACGGGTGCAATG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |