Regulog IolR - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Inositol utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By TF family - LacI
- By pathway - Inositol utilization
| Genome | Genes | Operons |
|---|---|---|
| Cellvibrio japonicus Ueda107 | ||
| Marinobacter aqueolei | ||
| Marinobacter sp. ELB17 | ||
| Saccharophagus degradans 2-40 | ||
| Teredinibacter turnerae T7901 | ||
| Alcanivorax borkumensis SK2 | ||
| Chromohalobacter salexigens DSM 3043 | ||
| Hahella chejuensis KCTC 2396 | 7 | 1 |
| Marinomonas sp. MWYL1 | ||
| Oceanobacter sp. RED65 | ||
| Oceanospirillum sp. MED92 | ||
| Reinekea sp. MED297 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| iolV |
|
|
|
|
|
|
|
*
Hahella chejuensis KCTC 2396 Site: position = -76 score = 6.12174 sequence = TTTTGCACACGGGTGCAATG Gene: HCH_03296: Predicted inositol ABC transporter, substrate-binding protein |
|
|
|
|
Predicted inositol ABC transporter, substrate-binding protein |
| iolW |
|
|
|
|
|
|
|
Gene: HCH_03297: Predicted inositol ABC transporter, permease protein 1 |
|
|
|
|
Predicted inositol ABC transporter, permease protein 1 |
| iolX |
|
|
|
|
|
|
|
Gene: HCH_03298: Predicted inositol ABC transporter, permease protein 2 |
|
|
|
|
Predicted inositol ABC transporter, permease protein 2 |
| iolY |
|
|
|
|
|
|
|
Gene: HCH_03299: Predicted inositol ABC transporter, ATP-binding protein |
Gene: Mmwyl1_2713: Predicted inositol ABC transporter, ATP-binding protein |
|
|
|
Predicted inositol ABC transporter, ATP-binding protein |
| iolZ |
|
|
|
|
|
|
|
Gene: HCH_03300: Predicted metal-dependent hydrolase |
Gene: Mmwyl1_0184: Predicted metal-dependent hydrolase |
|
|
|
Predicted metal-dependent hydrolase |
| suhB |
|
|
|
|
|
|
|
Gene: HCH_03301: Inositol-1-monophosphatase (EC 3.1.3.25) |
|
|
|
|
Inositol-1-monophosphatase (EC 3.1.3.25) |
| iolR |
|
|
|
|
|
|
|
Gene: HCH_03302: Inositol utilization transcriptional regulator IolR, LacI family |
|
|
|
|
Inositol utilization transcriptional regulator IolR, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |