Profile of regulator TrpR in Xanthomonadales
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Regulog: | TrpR - Xanthomonadales |
Member of regulog collections
- By taxonomy - Xanthomonadales
- By trascription factor - TrpR
- By TF family - TrpR
- By effector - Tryptophan
- By pathway - Tryptophan biosynthesis
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Xylella fastidiosa 9a5c | |||||
| XF1914 | trpE | -52 | 5.9 | CGTACTGATGTACCATTACA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |