Regulog TrpR - Xanthomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Tryptophan biosynthesis
Effector:	Tryptophan
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Xylella fastidiosa 9a5c	4	1
Xanthomonas axonopodis pv. citri str. 306
Xanthomonas campestris pv. campestris str. ATCC 33913
Stenotrophomonas maltophilia K279a

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
trpE	* Xylella fastidiosa 9a5c Site: position = -52 score = 5.92911 sequence = CGTACTGATGTACCATTACA Gene: XF1914: Anthranilate synthase, aminase component (EC 4.1.3.27)	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a	Anthranilate synthase, aminase component (EC 4.1.3.27)
trpG	Xylella fastidiosa 9a5c Gene: XF1915: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) @ Para-aminobenzoate synthase, amidotransferase component (EC 2.6.1.85)	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a	Anthranilate synthase, amidotransferase component (EC 4.1.3.27) @ Para-aminobenzoate synthase, amidotransferase component (EC 2.6.1.85)
COG1541	Xylella fastidiosa 9a5c Gene: XF1916: Coenzyme F390 synthetase	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a	Coenzyme F390 synthetase
SSF55729	Xylella fastidiosa 9a5c Gene: XF1917: Acyl-CoA N-acyltransferase	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a	Acyl-CoA N-acyltransferase

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --