Profile of regulator GlcC in Rhodobacterales
| Regulator family: | GntR/Others |
| Regulation mode: | activator (repressor) |
| Biological process: | Glycolate utilization |
| Effector: | Glycolate |
| Regulog: | GlcC - Rhodobacterales |
Member of regulog collections
- By taxonomy - Rhodobacterales
- By trascription factor - GlcC
- By TF family - GntR/Others
- By effector - Glycolate
- By pathway - Glycolate utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Paracoccus denitrificans PD1222 | |||||
| Pden_4399 | glcD | -71 | 6.1 | ATGTGGTCTGAAAATTATACCAAGA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |