Profile of regulator NadQ in Various betaproteobacteria
| Regulator family: | NadQ |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | |
| Regulog: | NadQ - Various betaproteobacteria |
Member of regulog collections
- By taxonomy - Various betaproteobacteria
- By trascription factor - NadQ
- By TF family - NadQ
- By pathway - NAD biosynthesis
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Neisseria meningitidis MC58 | |||||
| NMB0395 | nadQ | -132 | 6.5 | TTATGCTCAACTTGAGTATAA | |
| NMB0394 | nadA | -90 | 6.5 | TTATACTCAAGTTGAGCATAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |