Regulon of ModE in Ralstonia solanacearum GMI1000

Properties
Regulator type:	Transcription factor
TF locus tag:	RS05434
Regulator family:	ModE
Regulation mode:	repressor
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Ralstonia
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - ModE
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 4.8 Sequence: GGCGTTATATCGGCCCGTATATTACGAT Locus tag: RSp0106 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	RSp0106	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD