Regulog ModE - Ralstonia

Member of regulog collections
- By taxonomy - Ralstonia
- By trascription factor - ModE
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdenum homeostasis
Genome | Genes | Operons |
---|---|---|
Ralstonia solanacearum GMI1000 | 1 | 1 |
Ralstonia pickettii 12J | 3 | 2 |
Ralstonia metallidurans CH34 | 4 | 2 |
Ralstonia eutropha JMP134 | 3 | 1 |
Ralstonia eutropha H16 | 3 | 1 |
Cupriavidus taiwanensis | 3 | 1 |
Genes | Function | ||||||
---|---|---|---|---|---|---|---|
CRON 1. | |||||||
nifQ |
|
|
*
Ralstonia metallidurans CH34 Site: position = -73 score = 5.20213 sequence = GGCGTTATATACGTGGTTATATTGCGAT Gene: Rmet_4126: iron-molybdenum cofactor biosynthesis protein NifQ |
|
|
Gene: pRALTA_0376: iron-molybdenum cofactor biosynthesis protein NifQ |
iron-molybdenum cofactor biosynthesis protein NifQ |
CRON 2. | |||||||
modA |
*
Ralstonia solanacearum GMI1000 Site: position = -57 score = 4.81944 sequence = GGCGTTATATCGGCCCGTATATTACGAT Gene: RSp0106: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
*
Ralstonia pickettii 12J Site: position = -58 score = 4.35944 sequence = ACCGTTATATCGGCTCGTATATTACGCC Gene: Rpic_3851: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
*
Ralstonia metallidurans CH34 Site: position = -63 score = 4.84267 sequence = TGCGCTATATACCCGCTTATATTGCGCG Gene: Rmet_0571: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
*
Ralstonia eutropha JMP134 Site: position = -82 score = 4.8074 sequence = CTCGCTATATACAGCCTTATATTGCGCC Gene: Reut_A0634: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
*
Ralstonia eutropha H16 Site: position = -89 score = 5.00979 sequence = AGCGCTATATACAGACGTATATTGCGCG Gene: H16_A0677: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
*
Cupriavidus taiwanensis Site: position = -97 score = 4.69138 sequence = CGCGCTATATACAGACGTATATTGCGCC Gene: RALTA_A0633: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
modB |
Gene: RS05467: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
*
Ralstonia pickettii 12J Site: position = -119 score = 4.21705 sequence = GGCGTTATATCCAACCCTATATTTCGGA Gene: Rpic_4222: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Rmet_0570: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Reut_A0633: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: H16_A0676: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: RALTA_A0632: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) |
modC |
Gene: RS05462: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Rpic_4221: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Rmet_0569: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: Reut_A0632: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: H16_A0675: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: RALTA_A0631: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |