Regulon of IscR in Ralstonia metallidurans CH34

Properties
Regulator type:	Transcription factor
TF locus tag:	Rmet_1024
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Ralstonia
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -69 Score: 5.9 Sequence: GTACTTGACTGATTTAGTCGGAAAA Position: -40 Score: 6.2 Sequence: ATACTCGACCGAAATCCTCAAGTAT Locus tag: Rmet_1024 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Rmet_1025 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Rmet_1026 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Rmet_1027 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Rmet_1028 Name: hscB Funciton: Chaperone protein HscB Locus tag: Rmet_1029 Name: hscA Funciton: Chaperone protein HscA Locus tag: Rmet_1030 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: Rmet_1031 Name: yhfJ Funciton: putative Fe-S cluster assembly protein
	Rmet_1024	iscR	Iron-sulfur cluster regulator IscR
	Rmet_1025	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Rmet_1026	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Rmet_1027	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Rmet_1028	hscB	Chaperone protein HscB
	Rmet_1029	hscA	Chaperone protein HscA
	Rmet_1030	fdx	ferredoxin, 2Fe-2S type, ISC system
	Rmet_1031	yhfJ	putative Fe-S cluster assembly protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD