Regulon of IscR in Ralstonia eutropha JMP134

Properties
Regulator type:	Transcription factor
TF locus tag:	Reut_A1057
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Ralstonia
Statistics of regulated genes:
- Genes	9
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 6.9 Sequence: GTAGTTGACTGAAATAGTCGGGTAC Position: -37 Score: 6.8 Sequence: ATACTTGACGGAAACGATCAAGTAT Locus tag: Reut_A1057 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Reut_A1058 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Reut_A1059 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Reut_A1060 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Reut_A1061 Name: RSc1022 Funciton: hypothetical protein Locus tag: Reut_A1062 Name: hscB Funciton: Chaperone protein HscB Locus tag: Reut_A1063 Name: hscA Funciton: Chaperone protein HscA Locus tag: Reut_A1064 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: Reut_A1065 Name: yhfJ Funciton: putative Fe-S cluster assembly protein
	Reut_A1057	iscR	Iron-sulfur cluster regulator IscR
	Reut_A1058	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Reut_A1059	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Reut_A1060	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Reut_A1061	RSc1022	hypothetical protein
	Reut_A1062	hscB	Chaperone protein HscB
	Reut_A1063	hscA	Chaperone protein HscA
	Reut_A1064	fdx	ferredoxin, 2Fe-2S type, ISC system
	Reut_A1065	yhfJ	putative Fe-S cluster assembly protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD