Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulon of TunR in Desulfovibrio salexigens DSM 2638

Properties
Regulator type: Transcription factor
TF locus tag: Desal_0307
Regulator family: TunR
Regulation mode: activator
Biological process: Tungsten homeostasis; Molybdenum homeostasis
Effector: Molybdate; Tungsten
Regulog: TunR - Desulfovibrionales
Statistics of regulated genes:
- Genes 6
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 37 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -119
Score: 6.5
Sequence: CAGTCACGTTTTTATTAGAATGCGTGACCG
Locus tag: Desal_0306
Name: modA
Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: Desal_0305
Name: modB
Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: Desal_0304
Name: modC
Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Locus tag: Desal_0303
Name: modA
Funciton: ABC-type molybdate transport system, periplasmic component
Locus tag: Desal_0302
Name: modB
Funciton: ABC-type molybdate transport system, permease component
Locus tag: Desal_0301
Name: null
Funciton: hypothetical protein
modA
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modB
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
modC
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
modA
ABC-type molybdate transport system, periplasmic component
modB
ABC-type molybdate transport system, permease component
hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD