Regulon of TunR in Desulfovibrio piger ATCC 29098

Properties
Regulator type:	Transcription factor
TF locus tag:	DESPIG_00487
Regulator family:	TunR
Regulation mode:	activator
Biological process:	Tungsten homeostasis; Molybdenum homeostasis
Effector:	Molybdate; Tungsten
Regulog:	TunR - Desulfovibrionales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - TunR
By effector - Molybdate
By effector - Tungsten
By pathway - Tungsten homeostasis
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -99 Score: 5 Sequence: TTGTCGCGCTTTTCGTATAATCCGTGCCTG Locus tag: DESPIG_00488 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	DESPIG_00488	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD