Regulon of TunR in Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Properties
Regulator type:	Transcription factor
TF locus tag:	Ddes_0167
Regulator family:	TunR
Regulation mode:	activator
Biological process:	Tungsten homeostasis; Molybdenum homeostasis
Effector:	Molybdate; Tungsten
Regulog:	TunR - Desulfovibrionales
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - TunR
By effector - Molybdate
By effector - Tungsten
By pathway - Tungsten homeostasis
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -100 Score: 5 Sequence: TATTCACGATTATTATAAAAACCGTGAACA Locus tag: Ddes_0089 Name: null Funciton: TSUP family transporter
	Ddes_0089		TSUP family transporter
Position: -399 Score: 4.3 Sequence: TGTTCACGAAAATGAAAAATAGCGTGTAAA Locus tag: Ddes_1667 Name: phsA Funciton: molybdopterin oxidoreductase Locus tag: Ddes_1666 Name: phsB Funciton: Anaerobic dimethyl sulfoxide reductase chain B (EC 1.8.99.-)
	Ddes_1667	phsA	molybdopterin oxidoreductase
	Ddes_1666	phsB	Anaerobic dimethyl sulfoxide reductase chain B (EC 1.8.99.-)
Position: -85 Score: 5 Sequence: AGATCACGATTTACATAAAAAGCGTGAACA Locus tag: Ddes_0167 Name: TunR Funciton: XerD family transcriptional regulator
	Ddes_0167	TunR	XerD family transcriptional regulator
Position: -100 Score: 5 Sequence: TGTTCACGCTTTTTATGTAAATCGTGATCT Locus tag: Ddes_0168 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: Ddes_0169 Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: Ddes_0170 Name: modC Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
	Ddes_0168	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	Ddes_0169	modB	Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
	Ddes_0170	modC	Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD