Regulon of TunR in Desulfovibrio vulgaris str. Miyazaki F

Properties
Regulator type:	Transcription factor
TF locus tag:	DvMF_2476
Regulator family:	TunR
Regulation mode:	activator
Biological process:	Tungsten homeostasis; Molybdenum homeostasis
Effector:	Molybdate; Tungsten
Regulog:	TunR - Desulfovibrionales
Statistics of regulated genes:
- Genes	17
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - TunR
By effector - Molybdate
By effector - Tungsten
By pathway - Tungsten homeostasis
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -117 Score: 4.6 Sequence: TGTGCACGTTTTCTGCTTGTTTCGTGACTG Locus tag: DvMF_2780 Name: tupB Funciton: ABC-type tungstate transport system, periplasmic binding protein Locus tag: DvMF_2781 Name: tupA Funciton: ABC-type tungstate transport system, permease protein Locus tag: DvMF_2782 Name: tupC Funciton: ABC-type tungstate transport system, ATP-binding protein
	DvMF_2780	tupB	ABC-type tungstate transport system, periplasmic binding protein
	DvMF_2781	tupA	ABC-type tungstate transport system, permease protein
	DvMF_2782	tupC	ABC-type tungstate transport system, ATP-binding protein
Position: -83 Score: 6 Sequence: CAGGCACGGCCTGCCGGAAAATCGTGACCG Locus tag: DvMF_1233 Name: fdhE Funciton: formate dehydrogenase formation protein FdhE Locus tag: DvMF_1232 Name: fdhD Funciton: Formate dehydrogenase chain D (EC 1.2.1.2) Locus tag: DvMF_1231 Name: mobA Funciton: molybdopterin-guanine dinucleotide biosynthesis protein A, putative Locus tag: DvMF_1230 Name: moaA Funciton: Molybdenum cofactor biosynthesis protein MoaA
	DvMF_1233	fdhE	formate dehydrogenase formation protein FdhE
	DvMF_1232	fdhD	Formate dehydrogenase chain D (EC 1.2.1.2)
	DvMF_1231	mobA	molybdopterin-guanine dinucleotide biosynthesis protein A, putative
	DvMF_1230	moaA	Molybdenum cofactor biosynthesis protein MoaA
Position: -96 Score: 5.9 Sequence: CAGTCACGCGAACCATGCCGGACGTGACCC Locus tag: DvMF_0650 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
	DvMF_0650	modE	Molybdate-responsive transcriptional regulator ModE
Position: -145 Score: 4.9 Sequence: CGGTCACGATAATTTTATTTTGCATGGCTC Locus tag: DvMF_2403 Name: null Funciton: Molybdate-binding domain of ModE
	DvMF_2403		Molybdate-binding domain of ModE
Position: -108 Score: 5.7 Sequence: CGGTCACCTGGGCTGTTTTTTTCGTGACTG Locus tag: DvMF_2476 Name: TunR Funciton: XerD family transcriptional regulator
	DvMF_2476	TunR	XerD family transcriptional regulator
Position: -235 Score: 5.7 Sequence: CAGTCACGAAAAAAACAGCCCAGGTGACCG Locus tag: DvMF_2475 Name: null Funciton: COG1720: Uncharacterized conserved protein Locus tag: DvMF_2474 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	DvMF_2475		COG1720: Uncharacterized conserved protein
	DvMF_2474	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Position: -335 Score: 5.6 Sequence: CGGGCACGATATGTCCTGCTTTCGTGCCTG Position: -138 Score: 4.6 Sequence: TGGTCACGCGTGTATCGGAATGCGTGTTCC Locus tag: DvMF_0320 Name: phsA Funciton: molybdopterin oxidoreductase Locus tag: DvMF_0319 Name: phsB Funciton: 4Fe-4S ferredoxin, iron-sulfur binding domain protein
	DvMF_0320	phsA	molybdopterin oxidoreductase
	DvMF_0319	phsB	4Fe-4S ferredoxin, iron-sulfur binding domain protein
Position: -371 Score: 4.5 Sequence: CCTACACGCTTTGCATCCAACCCGTGACCA Position: -243 Score: 5.6 Sequence: ATGTCACGCCAAGTCGCGCTTCCGTGACTG Locus tag: DvMF_1613 Name: null Funciton: molybdopterin binding domain
	DvMF_1613		molybdopterin binding domain
Position: -67 Score: 5.4 Sequence: CGGTCACCAAGACGAAAGTTTTCGTGCCTC Locus tag: DvMF_2478 Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: DvMF_2477 Name: modC Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
	DvMF_2478	modB	Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
	DvMF_2477	modC	Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of TunR in Desulfovibrio vulgaris str. Miyazaki F

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --