Regulon of TunR in Desulfovibrio vulgaris Hildenborough

Properties
Regulator type:	Transcription factor
TF locus tag:	DVU0179
Regulator family:	TunR
Regulation mode:	activator
Biological process:	Tungsten homeostasis; Molybdenum homeostasis
Effector:	Molybdate; Tungsten
Regulog:	TunR - Desulfovibrionales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - TunR
By effector - Molybdate
By effector - Tungsten
By pathway - Tungsten homeostasis
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -102 Score: 6.3 Sequence: CGGTCACCCTCATGGTGACGAACGTGACCG Locus tag: DVU0179 Name: TunR Funciton: XerD family transcriptional regulator
	DVU0179	TunR	XerD family transcriptional regulator
Position: -132 Score: 6.3 Sequence: CGGTCACGTTCGTCACCATGAGGGTGACCG Locus tag: DVU0177 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	DVU0177	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Position: -219 Score: 5.4 Sequence: CGGTCACCACCCGGCAACATTCCGTGACCA Locus tag: DVU0181 Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: DVU0180 Name: modC Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
	DVU0181	modB	Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
	DVU0180	modC	Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD