Regulon of LysX in Desulfovibrio vulgaris str. Miyazaki F

Properties
Regulator type:	Transcription factor
TF locus tag:	DvMF_1011
Regulator family:	TrmB
Regulation mode:
Biological process:	Lysine biosynthesis
Effector:
Regulog:	LysX - Desulfovibrionales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - TrmB
By pathway - Lysine biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -265 Score: 6.1 Sequence: GTAGTACCAATCAGTACCAC Locus tag: DvMF_1011 Name: lysX Funciton: Transcriptional regulator, TrmB family Locus tag: DvMF_1010 Name: lysA-2 Funciton: Diaminopimelate decarboxylase (EC 4.1.1.20)
	DvMF_1011	lysX	Transcriptional regulator, TrmB family
	DvMF_1010	lysA-2	Diaminopimelate decarboxylase (EC 4.1.1.20)
Position: -328 Score: 5.6 Sequence: GTGGTTTCGTATAGTACCAC Locus tag: DvMF_3067 Name: mviN-1 Funciton: integral membrane protein MviN
	DvMF_3067	mviN-1	integral membrane protein MviN
Position: -529 Score: 5.6 Sequence: GTGGTACTATACGAAACCAC Locus tag: DvMF_3066 Name: null Funciton: hypothetical protein
	DvMF_3066		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD