Regulon of Zur in Paenibacillus sp. JDR-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pjdr2_2271
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Bacillales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 67 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -162 Score: 5.6 Sequence: TTAATCGTAATGTTGACGATTAA Position: -118 Score: 5.2 Sequence: TTATACGTAATTATTACGTTCAA Position: -67 Score: 5.8 Sequence: CTAATCGTAATAGTTACGAAATA Position: -35 Score: 5.1 Sequence: TTAATAGTAATGATTACGGAAAA Locus tag: Pjdr2_3065 Name: null Funciton: ABC-type Mn/Zn transport systems, ATPase component Locus tag: Pjdr2_3066 Name: null Funciton: ABC-type Mn2+/Zn2+ transport systems, permease component Locus tag: Pjdr2_3067 Name: null Funciton: ABC-type Mn2+/Zn2+ transport systems, Zn2+ binding protein Locus tag: Pjdr2_3068 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	Pjdr2_3065		ABC-type Mn/Zn transport systems, ATPase component
	Pjdr2_3066		ABC-type Mn2+/Zn2+ transport systems, permease component
	Pjdr2_3067		ABC-type Mn2+/Zn2+ transport systems, Zn2+ binding protein
	Pjdr2_3068	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -162 Score: 5.6 Sequence: TTAATCGTAATGTTGACGATTAA Position: -118 Score: 5.2 Sequence: TTATACGTAATTATTACGTTCAA Position: -67 Score: 5.8 Sequence: CTAATCGTAATAGTTACGAAATA Position: -35 Score: 5.1 Sequence: TTAATAGTAATGATTACGGAAAA Locus tag: Pjdr2_3065 Name: adcC Funciton: Mn2+/Zn2+ ABC transporter ATP-binding protein Locus tag: Pjdr2_3066 Name: adcB Funciton: Mn2+/Zn2+ ABC transporter permease Locus tag: Pjdr2_3067 Name: adcA Funciton: Mn2+/Zn2+ ABC transporter Zn(II)-binding lipoprotein Locus tag: Pjdr2_3068 Name: null Funciton: putitative GTPase
	Pjdr2_3065	adcC	Mn2+/Zn2+ ABC transporter ATP-binding protein
	Pjdr2_3066	adcB	Mn2+/Zn2+ ABC transporter permease
	Pjdr2_3067	adcA	Mn2+/Zn2+ ABC transporter Zn(II)-binding lipoprotein
	Pjdr2_3068		putitative GTPase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD