Regulon of Zur in Oceanobacillus iheyensis HTE831

Properties
Regulator type:	Transcription factor
TF locus tag:	OB2398
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Bacillales
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 67 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 6.2 Sequence: TAAATCGTAACCATTACGAATCG Position: -41 Score: 6 Sequence: CGAATCGTAATCATTACGATTAC Locus tag: OB1278 Name: zinT Funciton: candidate zinc-binding lipoprotein
	OB1278	zinT	candidate zinc-binding lipoprotein
Position: -82 Score: 6.3 Sequence: TTAATCGTAATGATTACGTTTTT Locus tag: OB3429 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	OB3429	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -247 Score: 6 Sequence: TTAATCGTAATCGTTACGATGTA Locus tag: OB3432 Name: rpsN2 Funciton: 30S ribosomal protein S14 Locus tag: OB3431 Name: null Funciton: hypothetical protein Locus tag: OB3430 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	OB3432	rpsN2	30S ribosomal protein S14
	OB3431		hypothetical protein
	OB3430	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -55 Score: 5 Sequence: TTATTCGTAATGATTACGGATAT Position: -40 Score: 6.9 Sequence: TAAATCGTAATGATTACGTTTTG Locus tag: OB3434 Name: OB3434 Funciton: Hypothetical protein Locus tag: OB3433 Name: null Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	OB3434	OB3434	Hypothetical protein
	OB3433		Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -297 Score: 6 Sequence: TAATTCGTAACGATTCCTATTTA Position: -274 Score: 5.1 Sequence: CATTTCATAATCATTACGCTATT Locus tag: OB2396 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: OB2397 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: OB2398 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	OB2396	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	OB2397	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	OB2398	zur	Zinc homeostasis transcriptional regulator Zur, Fur family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD