Regulon of Zur in Bacillus clausii KSM-K16

Properties
Regulator type:	Transcription factor
TF locus tag:	ABC1704
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Bacillales
Statistics of regulated genes:
- Genes	11
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 67 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 5.1 Sequence: TAAATCGGAAGCATTCTGAATAA Locus tag: ABC1702 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: ABC1703 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: ABC1704 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	ABC1702	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	ABC1703	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	ABC1704	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -54 Score: 6.8 Sequence: CAAAACGTAATAATTACGATTTA Locus tag: ABC1118 Name: zinT Funciton: candidate zinc-binding lipoprotein
	ABC1118	zinT	candidate zinc-binding lipoprotein
Position: -40 Score: 6.9 Sequence: TAATTCGTAATCATTACGATTTA Locus tag: ABC4020 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	ABC4020	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -45 Score: 6.1 Sequence: TAAATCGTAATAATAATGATTTT Locus tag: ABC4019 Name: rpsN2 Funciton: 30S ribosomal protein S14
	ABC4019	rpsN2	30S ribosomal protein S14
Position: -54 Score: 6.8 Sequence: CAAAACGTAATAATTACGATTTA Locus tag: ABC1118 Name: zinT Funciton: candidate zinc-binding lipoprotein Locus tag: ABC1117 Name: adcA Funciton: Mn2+/Zn2+ ABC transporter Zn(II)-binding lipoprotein Locus tag: ABC1116 Name: adcC Funciton: Mn2+/Zn2+ ABC transporter ATP-binding protein Locus tag: ABC1115 Name: adcB Funciton: Mn2+/Zn2+ ABC transporter permease
	ABC1118	zinT	candidate zinc-binding lipoprotein
	ABC1117	adcA	Mn2+/Zn2+ ABC transporter Zn(II)-binding lipoprotein
	ABC1116	adcC	Mn2+/Zn2+ ABC transporter ATP-binding protein
	ABC1115	adcB	Mn2+/Zn2+ ABC transporter permease
Position: -85 Score: 6.2 Sequence: TAAATCGTAATTGATACGATTTG Locus tag: ABC1119 Name: null Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	ABC1119		Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD