Regulon of Zur in Bacillus halodurans C-125

Properties
Regulator type:	Transcription factor
TF locus tag:	BH1396
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Bacillales
Statistics of regulated genes:
- Genes	9
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 67 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 5 Sequence: TAAATCGGAATGATTCTTAATAT Locus tag: BH1394 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: BH1395 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: BH1396 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	BH1394	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	BH1395	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	BH1396	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -195 Score: 6.7 Sequence: CAAAGCGTAATTATTACGATTTA Position: -54 Score: 5.5 Sequence: CAAATCGTAATGATAACTTTTAT Locus tag: BH1790 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	BH1790	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -40 Score: 6.6 Sequence: TAAATAGGAATTATTACGATTTA Locus tag: BH0366 Name: BH0366 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Locus tag: BH0367 Name: BH0367 Funciton: NADH-ubiquinone oxidoreductase 51 kDa subunit Locus tag: BH0368 Name: BH0368 Funciton: Deoxycytidine triphosphate deaminase (EC 3.5.4.13) Locus tag: BH0369 Name: sufE2 Funciton: Putative iron-sulfur cluster assembly scaffold protein for SUF system, SufE2
	BH0366	BH0366	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	BH0367	BH0367	NADH-ubiquinone oxidoreductase 51 kDa subunit
	BH0368	BH0368	Deoxycytidine triphosphate deaminase (EC 3.5.4.13)
	BH0369	sufE2	Putative iron-sulfur cluster assembly scaffold protein for SUF system, SufE2
Position: -41 Score: 6.2 Sequence: TAAATCGTAATTATTCTTATTTA Locus tag: BH0998 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
	BH0998	folE2	GTP cyclohydrolase I (EC 3.5.4.16) type 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD