Regulon of Zur in Bacillus cereus ATCC 14579

Properties
Regulator type:	Transcription factor
TF locus tag:	BC4277
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 67 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 6 Sequence: TAAATCGGAATCATTCTGAATTA Locus tag: BC4279 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: BC4278 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: BC4277 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	BC4279	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	BC4278	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	BC4277	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -93 Score: 6.9 Sequence: TAAATCGTAATCATTATGATTTA Position: -39 Score: 7 Sequence: TAAAACGTAATCATTACGATTTA Locus tag: BC1705 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	BC1705	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -55 Score: 7 Sequence: TAAATCGTAATCATTACGTTTTA Locus tag: BC4339 Name: rpmGA1 Funciton: 50S ribosomal protein L33
	BC4339	rpmGA1	50S ribosomal protein L33
Position: -68 Score: 6.7 Sequence: TAAATCGTAATTATTACGCTTTG Locus tag: BC1926 Name: null Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	BC1926		Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD