Regulon of Zur in Anoxybacillus flavithermus WK1

Properties
Regulator type:	Transcription factor
TF locus tag:	Aflv_0869
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 67 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -36 Score: 5.7 Sequence: TGAATCGGAATCATTTTGAATTA Locus tag: Aflv_0867 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Aflv_0868 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Aflv_0869 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	Aflv_0867	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Aflv_0868	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	Aflv_0869	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -40 Score: 7 Sequence: TAAATCGTAATGATTACGTTTTA Locus tag: Aflv_0397 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	Aflv_0397	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -45 Score: 6.3 Sequence: CAAAACGTAATGATTACTATTTT Locus tag: Aflv_1438 Name: rpmGA1 Funciton: 50S ribosomal protein L33
	Aflv_1438	rpmGA1	50S ribosomal protein L33

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD