Regulon of Zur in Bacillus pumilus SAFR-032

Properties
Regulator type:	Transcription factor
TF locus tag:	BPUM_2241
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Bacillales
Statistics of regulated genes:
- Genes	8
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 67 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 5.4 Sequence: TAAATCGTAATCATTCTTTTTAT Locus tag: BPUM_2243 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: BPUM_2242 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: BPUM_2241 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	BPUM_2243	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	BPUM_2242	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	BPUM_2241	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -69 Score: 6.6 Sequence: CAAATCGTAATCATTACTTTTTA Locus tag: BPUM_3311 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Locus tag: BPUM_3312 Name: rpsN2 Funciton: 30S ribosomal protein S14
	BPUM_3311	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	BPUM_3312	rpsN2	30S ribosomal protein S14
Position: -42 Score: 6.5 Sequence: CAAATCGTAACCATTACGAATTA Locus tag: BPUM_3310 Name: rpmGA1 Funciton: 50S ribosomal protein L33
	BPUM_3310	rpmGA1	50S ribosomal protein L33
Position: -44 Score: 6.5 Sequence: TAAAGCGTAATGATTACGTTTTG Locus tag: BPUM_2709 Name: rpmE2 Funciton: 50S ribosomal protein L31 type B
	BPUM_2709	rpmE2	50S ribosomal protein L31 type B
Position: -188 Score: 6.1 Sequence: TAGATAGAAATGATTACGATTTA Position: -151 Score: 6.5 Sequence: TGTATCGTAATAATTACGATTTG Locus tag: BPUM_2707 Name: ytiB Funciton: Carbonic anhydrase (EC 4.2.1.1)
	BPUM_2707	ytiB	Carbonic anhydrase (EC 4.2.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD