Regulon of MntR in Bacillus clausii KSM-K16

Properties
Regulator type:	Transcription factor
TF locus tag:	ABC2487
Regulator family:	DtxR
Regulation mode:	repressor (activator)
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Bacillales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -99 Score: 6 Sequence: AAAGTTGCATTAGAGAAACTTT Locus tag: ABC3961 Name: mntA Funciton: Manganase ABC transporter (binding protein) Locus tag: ABC3960 Name: mntB Funciton: Manganese ABC transporter (ATP-binding protein) Locus tag: ABC3959 Name: mntC Funciton: Manganese ABC transporter (permease) Locus tag: ABC3958 Name: mntD Funciton: Manganese ABC transporter (permease)
	ABC3961	mntA	Manganase ABC transporter (binding protein)
	ABC3960	mntB	Manganese ABC transporter (ATP-binding protein)
	ABC3959	mntC	Manganese ABC transporter (permease)
	ABC3958	mntD	Manganese ABC transporter (permease)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD