Regulon of MntR in Bacillus cereus ATCC 14579

Properties
Regulator type:	Transcription factor
TF locus tag:	BC4204
Regulator family:	DtxR
Regulation mode:	repressor (activator)
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Bacillales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -129 Score: 6.3 Sequence: TAATTTGCATTAAGGAAACTTT Locus tag: BC1803 Name: mntH Funciton: Manganese transport protein MntH
	BC1803	mntH	Manganese transport protein MntH
Position: -61 Score: 5.8 Sequence: AAAGTTTACCTTAGGAAACTTT Locus tag: BC0709 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: BC0708 Name: feoB1 Funciton: Ferrous iron transport protein B Locus tag: BC0707 Name: feoB2 Funciton: Ferrous iron transport protein B
	BC0709	feoA	Ferrous iron transport protein A
	BC0708	feoB1	Ferrous iron transport protein B
	BC0707	feoB2	Ferrous iron transport protein B

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD