Regulon of YtrA in Staphylococcus epidermidis ATCC 12228

Properties
Regulator type:	Transcription factor
TF locus tag:	SE1625
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Regulog:	YtrA - Staphylococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - GntR/Others
By pathway - Hypothetical ABC transporter

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 7 Sequence: TGTATATATTATGTATATACA Locus tag: SE1625 Name: ytrA Funciton: transcription regulator GntR family Locus tag: SE1624 Name: ytrB Funciton: ABC transporter (ATP-binding protein) Locus tag: SE1623 Name: SA1746 Funciton: putative membrane protein Locus tag: SE1622 Name: SA1745 Funciton: ABC transporter (ATP-binding protein) Locus tag: SE1621 Name: SA1744 Funciton: putative membrane protein
	SE1625	ytrA	transcription regulator GntR family
	SE1624	ytrB	ABC transporter (ATP-binding protein)
	SE1623	SA1746	putative membrane protein
	SE1622	SA1745	ABC transporter (ATP-binding protein)
	SE1621	SA1744	putative membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD