Regulog YtrA - Staphylococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Hypothetical ABC transporter |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By TF family - GntR/Others
- By pathway - Hypothetical ABC transporter
| Genome | Genes | Operons |
|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | 5 | 1 |
| Staphylococcus capitis SK14 | 5 | 1 |
| Staphylococcus epidermidis ATCC 12228 | 5 | 1 |
| Staphylococcus carnosus subsp. carnosus TM300 | 5 | 1 |
| Staphylococcus haemolyticus JCSC1435 | 5 | 1 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | 6 | 1 |
| Macrococcus caseolyticus JCSC5402 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| ytrA |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -42 score = 6.76542 sequence = TGTGTATATTGTATATATACA Gene: SA1748: transcription regulator GntR family |
*
Staphylococcus capitis SK14 Site: position = -40 score = 6.97084 sequence = TGTATATATTATGTATATACA Gene: STACA0001_1986: transcription regulator GntR family |
*
Staphylococcus epidermidis ATCC 12228 Site: position = -40 score = 6.97084 sequence = TGTATATATTATGTATATACA Gene: SE1625: transcription regulator GntR family |
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -38 score = 6.81284 sequence = TGTGTATACTGTGTATATACA Site: position = -128 score = 6.90576 sequence = TGTATATATACAATATATACA Gene: Sca_1508: transcription regulator GntR family |
*
Staphylococcus haemolyticus JCSC1435 Site: position = -41 score = 6.59051 sequence = TGTGTATACTATTTATATACA Site: position = -127 score = 6.40287 sequence = TGTATCTATAATGTATATACA Gene: SH1021: transcription regulator GntR family |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -40 score = 6.68949 sequence = TGTATATATTGCGTATATACA Gene: SSP0856: transcription regulator GntR family |
|
transcription regulator GntR family |
| ytrB |
Gene: SA1747: ABC transporter (ATP-binding protein) |
Gene: STACA0001_1985: ABC transporter (ATP-binding protein) |
Gene: SE1624: ABC transporter (ATP-binding protein) |
Gene: Sca_1507: ABC transporter (ATP-binding protein) |
Gene: SH1022: ABC transporter (ATP-binding protein) |
2
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP0858: ABC transporter (ATP-binding protein) Gene: SSP0857: ABC transporter (ATP-binding protein) |
|
ABC transporter (ATP-binding protein) |
| SA1746 |
Gene: SA1746: putative membrane protein |
Gene: STACA0001_1984: putative membrane protein |
Gene: SE1623: putative membrane protein |
Gene: Sca_1506: putative membrane protein |
Gene: SH1023: putative membrane protein |
Gene: SSP0859: putative membrane protein |
|
putative membrane protein |
| SA1745 |
Gene: SA1745: ABC transporter (ATP-binding protein) |
Gene: STACA0001_1983: ABC transporter (ATP-binding protein) |
Gene: SE1622: ABC transporter (ATP-binding protein) |
Gene: Sca_1505: ABC transporter (ATP-binding protein) |
Gene: SH1024: ABC transporter (ATP-binding protein) |
Gene: SSP0860: ABC transporter (ATP-binding protein) |
|
ABC transporter (ATP-binding protein) |
| SA1744 |
Gene: SA1744: putative membrane protein |
Gene: STACA0001_1982: putative membrane protein |
Gene: SE1621: putative membrane protein |
Gene: Sca_1504: putative membrane protein |
Gene: SH1025: putative membrane protein |
Gene: SSP0861: putative membrane protein |
|
putative membrane protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |