Regulon of TreR in Staphylococcus haemolyticus JCSC1435

Properties
Regulator type:	Transcription factor
TF locus tag:	SH0574
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose-6-phosphate
Regulog:	TreR - Staphylococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - GntR/Others
By effector - Trehalose-6-phosphate
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 6.5 Sequence: AAAACTTGTCTAGACAAGTTAT Locus tag: SH2538 Name: treP Funciton: phosphotransferase system trehalose-specific enzyme IIBC component homolog Locus tag: SH2537 Name: treA Funciton: trehalose-6-phosphate hydrolase Locus tag: SH2536 Name: treR Funciton: trehalose-6-phosphate-responsive transcriptional regulator
	SH2538	treP	phosphotransferase system trehalose-specific enzyme IIBC component homolog
	SH2537	treA	trehalose-6-phosphate hydrolase
	SH2536	treR	trehalose-6-phosphate-responsive transcriptional regulator

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD