Regulog TreR - Staphylococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Trehalose utilization |
| Effector: | Trehalose-6-phosphate |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By TF family - GntR/Others
- By effector - Trehalose-6-phosphate
- By pathway - Trehalose utilization
| Genome | Genes | Operons |
|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | 3 | 1 |
| Staphylococcus capitis SK14 | ||
| Staphylococcus epidermidis ATCC 12228 | ||
| Staphylococcus carnosus subsp. carnosus TM300 | 4 | 1 |
| Staphylococcus haemolyticus JCSC1435 | 3 | 1 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | 3 | 1 |
| Macrococcus caseolyticus JCSC5402 | 2 | 1 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| treP |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -54 score = 7.01828 sequence = ATAACTTGTCTAGACAAGTTAT Gene: SA0432: phosphotransferase system trehalose-specific enzyme IIBC component homolog |
|
|
*2
Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_0109: phosphotransferase system trehalose-specific enzyme IIBC component homolog Site: position = -57 score = 5.92347 sequence = ATAACTTGTCTAGACAAGTACA Gene: Sca_0108: phosphotransferase system trehalose-specific enzyme IIBC component homolog |
*
Staphylococcus haemolyticus JCSC1435 Site: position = -55 score = 6.54258 sequence = AAAACTTGTCTAGACAAGTTAT Gene: SH2538: phosphotransferase system trehalose-specific enzyme IIBC component homolog |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -67 score = 6.76146 sequence = AAAACTTGTATAGACAAGTTAT Gene: SSP2282: phosphotransferase system trehalose-specific enzyme IIBC component homolog |
Gene: MCCL_1938: phosphotransferase system trehalose-specific enzyme IIBC component homolog |
phosphotransferase system trehalose-specific enzyme IIBC component homolog |
| treA |
Gene: SA0433: trehalose-6-phosphate hydrolase |
|
|
Gene: Sca_0110: trehalose-6-phosphate hydrolase |
Gene: SH2537: trehalose-6-phosphate hydrolase |
Gene: SSP2281: trehalose-6-phosphate hydrolase |
*
Macrococcus caseolyticus JCSC5402 Site: position = -65 score = 5.69433 sequence = ACAACTTGTAAATACATGTTGT Gene: MCCL_1937: trehalose-6-phosphate hydrolase |
trehalose-6-phosphate hydrolase |
| treR |
Gene: SA0434: trehalose-6-phosphate-responsive transcriptional regulator |
|
|
Gene: Sca_0111: trehalose-6-phosphate-responsive transcriptional regulator |
Gene: SH2536: trehalose-6-phosphate-responsive transcriptional regulator |
Gene: SSP2280: trehalose-6-phosphate-responsive transcriptional regulator |
Gene: MCCL_1936: trehalose-6-phosphate-responsive transcriptional regulator |
trehalose-6-phosphate-responsive transcriptional regulator |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |