Regulon of ScrR in Macrococcus caseolyticus JCSC5402

Properties
Regulator type:	Transcription factor
TF locus tag:	MCCL_0372
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose-6-phosphate
Regulog:	ScrR - Staphylococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - LacI
By effector - Sucrose-6-phosphate
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -30 Score: 6.1 Sequence: AAATGGAACCGGTTCCAAAG Locus tag: MCCL_0373 Name: scrB Funciton: sucrose-6-phosphate hydrolase Locus tag: MCCL_0374 Name: scrK Funciton: fructokinase Locus tag: MCCL_0375 Name: scrA2 Funciton: non-orthologous PTS system sucrose-specific IIBC component
	MCCL_0373	scrB	sucrose-6-phosphate hydrolase
	MCCL_0374	scrK	fructokinase
	MCCL_0375	scrA2	non-orthologous PTS system sucrose-specific IIBC component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD