Regulon of ScrR in Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Properties
Regulator type:	Transcription factor
TF locus tag:	SSP0836
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose-6-phosphate
Regulog:	ScrR - Staphylococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - LacI
By effector - Sucrose-6-phosphate
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 6.2 Sequence: AAATGGAACCGGTACCAAAA Locus tag: SSP0837 Name: scrB Funciton: sucrose-6-phosphate hydrolase Locus tag: SSP0838 Name: scrK Funciton: fructokinase
	SSP0837	scrB	sucrose-6-phosphate hydrolase
	SSP0838	scrK	fructokinase
Position: -68 Score: 5.7 Sequence: AGTTGGAACCGGTTACAATA Position: -37 Score: 6.2 Sequence: TTTTGGTACCGGTTCCATTT Locus tag: SSP0512 Name: scrA Funciton: PTS system sucrose-specific IIBC component
	SSP0512	scrA	PTS system sucrose-specific IIBC component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD