Regulon of ScrR in Staphylococcus epidermidis ATCC 12228

Properties
Regulator type:	Transcription factor
TF locus tag:	SE1643
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose-6-phosphate
Regulog:	ScrR - Staphylococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - LacI
By effector - Sucrose-6-phosphate
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -233 Score: 5.7 Sequence: AAATGGAACCGATACCACAT Locus tag: SE1640 Name: scrB Funciton: sucrose-6-phosphate hydrolase Locus tag: SE1639 Name: scrK Funciton: fructokinase
	SE1640	scrB	sucrose-6-phosphate hydrolase
	SE1639	scrK	fructokinase
Position: -60 Score: 5.9 Sequence: GATTGGAACCGGTTACAATA Position: -31 Score: 5 Sequence: TATTTGAATCGGTTCTAAAA Locus tag: SE1959 Name: scrA Funciton: PTS system sucrose-specific IIBC component
	SE1959	scrA	PTS system sucrose-specific IIBC component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD