Regulon of LexA in Macrococcus caseolyticus JCSC5402

Properties
Regulator type:	Transcription factor
TF locus tag:	MCCL_0995
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Staphylococcaceae
Statistics of regulated genes:
- Genes	8
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 5.2 Sequence: TTTCGAACGTATGTTTGTAG Locus tag: MCCL_1011 Name: parE Funciton: DNA topoisomerase IV subunit B Locus tag: MCCL_1012 Name: parC Funciton: DNA topoisomerase IV subunit A
	MCCL_1011	parE	DNA topoisomerase IV subunit B
	MCCL_1012	parC	DNA topoisomerase IV subunit A
Position: -135 Score: 4.9 Sequence: CCTAGAACATTTGTTTGTAT Position: -77 Score: 5.7 Sequence: ATACGAACAAATGTTTGTTA Locus tag: MCCL_0995 Name: lexA Funciton: SOS regulatory LexA protein
	MCCL_0995	lexA	SOS regulatory LexA protein
Position: -132 Score: 5.2 Sequence: ATACAAACAGACGTTCGCAT Locus tag: MCCL_0875 Name: recA Funciton: recombinase A
	MCCL_0875	recA	recombinase A
Position: -34 Score: 5.4 Sequence: AACAGAACGTACGTTCGTAT Locus tag: MCCL_1665 Name: null Funciton: SPBc2 prophage-derived uncharacterized protein
	MCCL_1665		SPBc2 prophage-derived uncharacterized protein
Position: -38 Score: 5.4 Sequence: ATAAGAACATACGTTCTATT Position: -10 Score: 4.9 Sequence: AATAGAACGTATGTTCTGGT Locus tag: MCCL_1033 Name: uvrX Funciton: Putative UV-damage repair protein
	MCCL_1033	uvrX	Putative UV-damage repair protein
Position: -67 Score: 5.3 Sequence: TTACGAACAAATGTTTGTAC Locus tag: MCCL_0509 Name: uvrB Funciton: excinuclease ABC subunit B Locus tag: MCCL_0510 Name: uvrA Funciton: exinuclease ABC subunit A
	MCCL_0509	uvrB	excinuclease ABC subunit B
	MCCL_0510	uvrA	exinuclease ABC subunit A

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD